<%= term._highlightResult.name.value %>
Are you the creator of this tool? Sign up to claim your tool
Suggested by: Roopesh Singh
Sequence Massager is a handy and quick tool to clean nucleic acid sequences: reverse-complement, change CAPS, remove line breaks, numbers, white spaces, etc. DNA->RNA, RNA->DNA... The interface is very simple and easy
revers primer Oval 17
This primer designe for rial time PCR BY SYBER green
@Ali.Askari.548:u note that this is not a tool for designing primers.. please try @primerblast
REVERSE PRIMER Oval 17
I have sequence 3AGTAGACTCTTCTGACCCGC5 to design reverse primer.please help me.
Ali Askari
Bioinformatician at UNIrevers primer
This primer designe for rial time PCR BY SYBER green
Roy Winters
Research Fellow at University of Melbourne@Ali.Askari.548:u note that this is not a tool for designing primers.. please try @primerblast
Ali Askari
Bioinformatician at UNIREVERSE PRIMER
I have sequence 3AGTAGACTCTTCTGACCCGC5 to design reverse primer.please help me.