<% _.each(terms.slice(0, 3), function(term, idx) { %>

<%= term._highlightResult.name.value %>

<% }) %>
Tools
Discover the best online tools to assist you in research

Sequence Massager

Are you the creator of this tool?

Suggested by: Roopesh Singh

Description

Sequence Massager is a handy and quick tool to clean nucleic acid sequences: reverse-complement, change CAPS, remove line breaks, numbers, white spaces, etc. DNA->RNA, RNA->DNA...

The interface is very simple and easy

Discussion

Ask a question or post a review

Di Zhang
Post-doc at UTSOUTHWESTERN
View profile

Di Zhang

Post-doc at UTSOUTHWESTERN

siRNA design Oval 17

For transfer DNA to RNA

upvotecomment_icon_normal 1 upvotes 0 comments Reply
Posted: 2 weeks ago
Ali Askari
Bioinformatician at UNI
View profile

Ali Askari

Bioinformatician at UNI

revers primer Oval 17

This primer designe for rial time PCR BY SYBER green

upvotecomment_icon_normal 1 upvotes 1 comments Reply
Posted: 1 year ago
Ali Askari
Bioinformatician at UNI
View profile

Ali Askari

Bioinformatician at UNI

REVERSE PRIMER Oval 17

I have sequence 3AGTAGACTCTTCTGACCCGC5 to design reverse primer.please help me.

upvotecomment_icon_normal 2 upvotes 0 comments Reply
Posted: 1 year ago
75  upvotes
4 collections
4022 views
Show more

Associated keywords

Nucleic Acids